Category Archives: School Malaise Trap Program

Back at BIO, School Malaise Trap Program

Here come the DNA barcodes!

Leave a comment

The School Malaise Trap Program samples have all been databased, counted, sorted, and tissue sampled, as we learned in the latest blog post from the Collections Unit at the Biodiversity Institute of Ontario. Those plates of tissue samples were then passed on to the another unit in BIO — the Canadian Centre for DNA Barcoding. It’s here that the samples go through several laboratory stages (DNA extraction, PCR amplification, cycle sequencing, and sequence analysis) to determine the DNA barcode of each specimen. This lab work is well underway, and we’re happy to report that the very first SMTP DNA barcodes have come off the sequencer and have been submitted to the Barcode of Life Database (BOLD). At of the time of this post, there are over 1300 barcodes now online, with several thousand more to come over the next two weeks!

If you’re like us and you just can’t wait to see an example of what’s living in the SMTP schoolyards, here’s one of the first DNA barcodes to come off the sequencer:

ACTTTATATTTTATATTTGGAGCTTGATCTGCTATAGCTGGAACAGCTATAAGAATTTTAATTCGAATGGAATTAGGACAGTTAGGATCTTTTTTAGGAGATGATCAATTATATAATGTTGTAGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATCTTAATTGGTGGTTTTGGAAATTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATTTAAGATTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTGGAAATAGGAGTTGGTGCTGGATGAACTGTGTATCCTCCTTTAGCATCAGTTATAGGACATGCTGGAAGTTCAGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGAGTATCTTCAATTATAGGAGCTATTAATTTTATTTCTACAATTATTAACATACGCTTATTTAGAATATCTATGGAAAAGATTCCTTTATTTGTATGATCAGTATTAATTACTGCTATTTTATTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAACTTTAAT

Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding
Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding

This mystery specimen was collected in the malaise trap deployed by our friends at College Notre-Dame in Sudbury. If you go to the BOLD Identification Engine and paste the DNA sequence in the text box, then hit submit, it will tell you what the sequence matches to in our extensive DNA barcode library. Voilà — you know what species was collected! Give it a try, and if you did it correctly, the identification should be this species (SPOILER ALERT!).

Back at BIO, School Malaise Trap Program

Anxiously Awaiting Samples

Leave a comment

The Collections Unit at the Biodiversity Institute of Ontario (BIO) is extremely excited that we’ll soon be helping out with this fall’s edition of the School Malaise Trap Program (SMTP).  We are anxiously awaiting the samples to arrive next week, when we finally get to do our part in the ‘DNA barcoding’ process.  Our unit is basically responsible for all the steps leading up to the lab work – we collect specimens in the field, sort the trap samples and specimens, then database, photograph and tissue sample.  That small piece of tissue (or the entire specimen for very small organisms) is then handed off to the laboratory where that unit is responsible for DNA extraction, amplification of the DNA barcode region, and finally DNA sequencing. For the SMTP, we’re getting hundreds of young biologists helping with the field collection, and we can’t wait to see what they trapped in their schoolyards.  Who knows – maybe they’ll collect species we’ve never found before and they’ll have to give us advice!

Stay tuned for an update from us next week when the samples have arrived and we’re ‘forceps-deep’ in all the great trap samples collected through the SMTP.

Fall 2014, School Malaise Trap Program

#SMTPselfie – Share your Malaise Trap Selfie and your class could win a prize!!

Leave a comment

Today the School Malaise Trap Program team decided to start a new trend…taking a selfie with your Malaise trap! We are also offering a prize to classes who enter a selfie (yup, you can enter more than one)! We encourage all classes to participate and post your #SMTPselfie on our blog or tweet at us (@SMTP_Canada). You can also email us your selfie and we will post it on your behalf. Once a class has submitted their selfie, they will be entered into a draw for one of our prizes! Further prize details to come.

Check out our #SMTPselfie below!
20140925_135902

Back at BIO, Fall 2014, School Malaise Trap Program

Pack, Stack and Go! Preparing for the School Malaise Trap Program.

Leave a comment

This is truly one of the most exciting and busy times of year for staff from all departments at the Biodiversity Institute of Ontario! Preparing for the School Malaise Trap Program requires extensive planning, coordination, organization, and a LOT of tape (with a little luck thrown in along the way).

And here we are! The program packages have been sent out, and shortly, students from 61 schools across Canada will be monitoring a Malaise Trap in their schoolyard for a 2 week period from September 22nd – October 3rd, 2014, in order to assess their local insect biodiversity.

When we mentioned a lot of tape, we meant it! Check out the picture below of our School Malaise Trap Program packages right before they were about to be shipped – 61 packages in total!

2014-09-11 10.32.38

So let us tell you a little bit about how we got to this stage and what can be found in each of these boxes. Each package is 30″ x 14″ x 7″ and weighs approximately 14 lbs. Individual packages will contain a Malaise Trap, which is about the size of a small tent (6 feet tall and 6 feet long), a program information folder for instructors, and a “research in progress” sign which is to be placed on the Malaise Trap once it is assembled. We also include swag, such as buttons and bookmarks, for all of the students involved in the program. Currently, we have 2,526 students enrolled in the Fall 2014 version of the program from 94 classrooms. Literally, this means that staff at BIO must count out the appropriate number of bookmarks, buttons, pens etc… for each student in each of the participating classes! As you can imagine, this process can be quite time consuming so we do our best to start preparing for each program as soon as possible!

Back at BIO, School Malaise Trap Program

In the Beginning

Leave a comment

As we look forward to the Fall 2014 School Malaise Trap Program, we find ourselves reflecting upon how it all began. The SMTP website was in its infancy, and certainly didn’t include any sort of blog, but our friends at the BIObus were excited to share some thoughts about the birth of this program.

Here’s the first blog post related to the School Malaise Trap Program, copied from the BIObus site:

60 schools, 2000 SMTP-logostudents,
2 weeks, 12000 DNA barcodes.

Starting tomorrow — Feb. 26, 2013 — the Biodiversity Institute of Ontario (BIO) will team up with grade 6 and grade 12 students from 60 schools to explore the insect diversity in their schoolyards through DNA barcoding, a genetic technique for identifying organisms. Using a Malaise trap — a small tent-like apparatus for collecting insects — each school will collect hundreds of insect specimens.

Each school will be visited by the BIObus, BIO’s mobile field laboratory, to introduce students to the life of a biologist and DNA barcoding. A comprehensive lesson plan accompanies the project and addresses specific expectations in the grades 6 and 12 curricula.

Once each class has deployed their Malaise trap for two weeks in April 2013, the samples will be analyzed at BIO and each class will receive a report providing a summary of the insects collected at each school. It will highlight new discoveries, and make comparisons between schools and nearby National Parks.

Stay tuned for many more updates over the next several weeks.  Check here on the BIObus blog, but also:

The School Malaise Trap website
The BIObus Facebook page
The BIObus twitter feed: @BIObus_Canada
The DNA Barcoding blog