Here come the DNA barcodes!

The School Malaise Trap Program samples have all been databased, counted, sorted, and tissue sampled, as we learned in the latest blog post from the Collections Unit at the Biodiversity Institute of Ontario. Those plates of tissue samples were then passed on to the another unit in BIO — the Canadian Centre for DNA Barcoding. It’s here that the samples go through several laboratory stages (DNA extraction, PCR amplification, cycle sequencing, and sequence analysis) to determine the DNA barcode of each specimen. This lab work is well underway, and we’re happy to report that the very first SMTP DNA barcodes have come off the sequencer and have been submitted to the Barcode of Life Database (BOLD). At of the time of this post, there are over 1300 barcodes now online, with several thousand more to come over the next two weeks!

If you’re like us and you just can’t wait to see an example of what’s living in the SMTP schoolyards, here’s one of the first DNA barcodes to come off the sequencer:

ACTTTATATTTTATATTTGGAGCTTGATCTGCTATAGCTGGAACAGCTATAAGAATTTTAATTCGAATGGAATTAGGACAGTTAGGATCTTTTTTAGGAGATGATCAATTATATAATGTTGTAGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATCTTAATTGGTGGTTTTGGAAATTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATTTAAGATTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTGGAAATAGGAGTTGGTGCTGGATGAACTGTGTATCCTCCTTTAGCATCAGTTATAGGACATGCTGGAAGTTCAGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGAGTATCTTCAATTATAGGAGCTATTAATTTTATTTCTACAATTATTAACATACGCTTATTTAGAATATCTATGGAAAAGATTCCTTTATTTGTATGATCAGTATTAATTACTGCTATTTTATTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAACTTTAAT

Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding
Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding

This mystery specimen was collected in the malaise trap deployed by our friends at College Notre-Dame in Sudbury. If you go to the BOLD Identification Engine and paste the DNA sequence in the text box, then hit submit, it will tell you what the sequence matches to in our extensive DNA barcode library. Voilà — you know what species was collected! Give it a try, and if you did it correctly, the identification should be this species (SPOILER ALERT!).

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.