Category Archives: Back at BIO

Here come the DNA barcodes!

The School Malaise Trap Program samples have all been databased, counted, sorted, and tissue sampled, as we learned in the latest blog post from the Collections Unit at the Biodiversity Institute of Ontario. Those plates of tissue samples were then passed on to the another unit in BIO — the Canadian Centre for DNA Barcoding. It’s here that the samples go through several laboratory stages (DNA extraction, PCR amplification, cycle sequencing, and sequence analysis) to determine the DNA barcode of each specimen. This lab work is well underway, and we’re happy to report that the very first SMTP DNA barcodes have come off the sequencer and have been submitted to the Barcode of Life Database (BOLD). At of the time of this post, there are over 1300 barcodes now online, with several thousand more to come over the next two weeks!

If you’re like us and you just can’t wait to see an example of what’s living in the SMTP schoolyards, here’s one of the first DNA barcodes to come off the sequencer:

ACTTTATATTTTATATTTGGAGCTTGATCTGCTATAGCTGGAACAGCTATAAGAATTTTAATTCGAATGGAATTAGGACAGTTAGGATCTTTTTTAGGAGATGATCAATTATATAATGTTGTAGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATCTTAATTGGTGGTTTTGGAAATTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATTTAAGATTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTGGAAATAGGAGTTGGTGCTGGATGAACTGTGTATCCTCCTTTAGCATCAGTTATAGGACATGCTGGAAGTTCAGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGAGTATCTTCAATTATAGGAGCTATTAATTTTATTTCTACAATTATTAACATACGCTTATTTAGAATATCTATGGAAAAGATTCCTTTATTTGTATGATCAGTATTAATTACTGCTATTTTATTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAACTTTAAT

Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding
Victoria prepares a PCR reaction in the Canadian Centre for DNA Barcoding

This mystery specimen was collected in the malaise trap deployed by our friends at College Notre-Dame in Sudbury. If you go to the BOLD Identification Engine and paste the DNA sequence in the text box, then hit submit, it will tell you what the sequence matches to in our extensive DNA barcode library. Voilà — you know what species was collected! Give it a try, and if you did it correctly, the identification should be this species (SPOILER ALERT!).

Step 1: Sorting and Imaging your Samples

Hello School Malaise Trap Program participants,

So far, our Collections team here at BIO has provided you with amazing first-hand accounts of what happens to your specimens once they arrive at our facilities to be DNA barcoded. During this blog post, we are going to show you what our facilities and the DNA barcoding process looks like.

Below, you will find an educational video which explains the first steps towards ultimately obtaining a DNA barcode – sorting and imaging your specimen.

Stay tuned for our next video which will showcase our lab and sequencing processes!

Processing Malaise Traps from Schools Across Canada

The Collections team has worked hard the past 2 weeks sorting and preparing samples collected from schools around the country for this fall’s School Malaise Trap Program. Our first step was to count the specimens in each sample bottle and our grand total from 59 schools was 61,052 specimens! Our team then sorted through all those specimens to choose a select number from each school to represent the diversity found at all locations. We choose 16,045 specimens for DNA barcoding.

A large spider from the malaise trap samples
A large spider from the malaise trap samples

There was plenty of diversity of organisms found, ranging from 5 classes of animals – Insecta (insects), Arachnida (spiders, mites and their relatives), Gastropoda (snails and slugs), Diplopoda (millipedes), and Collembola (springtails). Within the insect group we revealed 14 orders including the more common Diptera (flies), Hymenoptera (wasps, bees, and ants), Lepidoptera (moths and butterflies), Coleoptera (beetles) and Hemiptera (true bugs). Some uncommon insects found were one odonate (dragonfly) from St. Ignatius of Loyola Catholic Elementary School in Guelph, Ontario and one plecopteran (stonefly) from Carleton North High School in Florenceville-Bristol, New Brunswick.

An array of pinned specimens ready to be sampled for DNA barcoding
An array of pinned specimens ready to be sampled for DNA barcoding

The next step is the DNA barcoding process in the lab where DNA is extracted, amplified and sequenced to give us our barcodes for each specimen. We target a specific piece of DNA that can help us identify what we found. The sequences are uploaded to our online database BOLD and compared to known sequences to confirm identification of the specimens.

Results will start pouring in the next few weeks… I wonder what school will have the highest diversity? What school collected the most specimens? Who discovered a new species?

Week One: Sorting, sorting, and more sorting

Hello School Malaise Trap Program Participants!

After 1 week of processing, we are already 85% done! It’s been quite a busy week on our end, counting and observing all the amazing bugs that were collected in your school backyard. We have already counted more than 55,000 specimens and more to come! Some schools did collect quite a fair bit of insects in their trap as you can see in the photo below!

Samples

There is still more processing to be done and more plates to be sent to the lab, but we can’t wait to receive all the sequences back to share our discoveries with you!

Samples are Arriving at BIO!

Hello School Malaise Trap Program Participants!

We are happy to say that we have received almost all of your Malaise trap samples for the Fall 2014 program! The rest of the samples are on their way, and we can’t wait to see what you have all collected.

Once your samples arrive at BIO, they go straight to our Collections unit, where they will be sorted by insect Order. As you can see from the photo below, this can be quite a long and meticulous process.

20141008_124327

Stay tuned for an update from our Collections unit soon!

Meet Helix! (Mantis religiosa)

Meet Helix (the European Mantis)!

A few days ago, one of our collections technicians, Valerie, spotted a European Mantis (Mantis religiosa) while working in the Arboretum at the University of Guelph. Valerie is a fantastic photographer and has graciously shared some of her pictures of Helix with us.

As you can tell by his species name, Helix is native to Europe, Africa and Asia and was introduced to North America in 1899. The European Mantis is now found across Canada as well as throughout northern parts of the United States.

VLB_Photo_140930_IMG_9067

The European Mantis can live in a variety of habitats, but seems to prefer green growth and sunny areas by shrubbery or herbaceous plants.

VLB_Photo_140930_IMG_9126

Helix will prey on several different kinds of insects including moths, caterpillars, butterflies and bees. Here Helix is pictured munching on a cricket.

VLB_Photo_140930_IMG_9089

The European species comes in a wide variety of colours ranging from dark brown to bright green. Like all Mantids, the female is larger than the male, especially at the abdomen. Due to their size, females are unlikely to fly and will scare off predators by flaring their wings and raising their arms. After mating, females have been known to consume the male they reproduce with.

Anxiously Awaiting Samples

The Collections Unit at the Biodiversity Institute of Ontario (BIO) is extremely excited that we’ll soon be helping out with this fall’s edition of the School Malaise Trap Program (SMTP).  We are anxiously awaiting the samples to arrive next week, when we finally get to do our part in the ‘DNA barcoding’ process.  Our unit is basically responsible for all the steps leading up to the lab work – we collect specimens in the field, sort the trap samples and specimens, then database, photograph and tissue sample.  That small piece of tissue (or the entire specimen for very small organisms) is then handed off to the laboratory where that unit is responsible for DNA extraction, amplification of the DNA barcode region, and finally DNA sequencing. For the SMTP, we’re getting hundreds of young biologists helping with the field collection, and we can’t wait to see what they trapped in their schoolyards.  Who knows – maybe they’ll collect species we’ve never found before and they’ll have to give us advice!

Stay tuned for an update from us next week when the samples have arrived and we’re ‘forceps-deep’ in all the great trap samples collected through the SMTP.

Catching Crane Flies at BIO!

Hello All,

Vanessa here! Today Emily and I went out to change the bottle on the Malaise trap that we have set up in front of the Biodiversity Institute of Ontario (BIO). We have had this trap out all summer and mainly use it for educational purposes, such as teaching school groups about insect trapping methods. The last time we changed the bottle was approximately two weeks ago and we were thrilled to see that the bottle was quite full!

Emily and I were quite curious about what we caught, so we decided to take a sneak peek. Peering into the bottle, we noticed an abundance of a large mosquito-like insect, commonly called a crane fly.

20140924_101329

Crane flies come from the family Tipulidae and there are over 4,000 species found worldwide. Although they look like large mosquitoes, crane flies will not bite animals or humans. Crane flies will feed on nectar, or they will not eat at all; most adult crane flies will only mate then die. Because many species of crane flies are quite large and very abundant, they are easily preyed upon by birds, mammals, fishes, and other vertebrates, as well as by spiders and predacious insects.

C.C. Derek Parker Flickr Creative Commons
C.C. Derek Parker
Flickr Creative Commons

We are excited to hear about what you caught in your traps!